DNA ARTICLES
|
This is the first of three articles written by Ron East on the subject of DNA which were published in our POINTS EAST Journal. |
|
IT’S ALL IN THE GENES
|
This is the first of three articles about DNA and how it is used in family history research. This first article is about DNA itself – what it is and what it does. The next article will be about the Y-chromosomal DNA and the last article about mitochondrial DNA. Words appearing in bold italic type are referred to in a Glossary at the end of the article. I hope when we have finished these articles that you will be able to understand fully what a DNA test certificate means.
|
DNA is
amazing stuff.
It is the stuff that makes us what we are: whether a human being or a fruit fly, whether male or female, the colour of our eyes, how tall we will grow - indeed every feature that makes each one of us so special. |
Human
beings are made of cells. Some are muscle cells, some are brain cells, some are bone
cells, some are blood cells, some are fat cells (that we would like fewer of,
particularly after Christmas); they all come together in the right number and
in the right order to build a human being. An adult human is made up of 100
thousand billion cells. If you were to count the cells in your body, non
stop, at the rate of one cell every second, you would still be counting them 3
million years from now – about the age of the oldest human fossil record on
earth. It would make you something of a fossil, too, if you were still around
to count them!
It
is in the central region of the cell called the nucleus that DNA is found. The nucleus contains 46
thread-like molecules called chromosomes
(but see below about the sex cells). It is these chromosomes that are made from DNA. They are the
blueprints that make us what we are: they are our genetic code.
Amazingly, every cell in your body contains an identical set of these 46 chromosomes. In other words, every cell contains a complete copy of your genetic code - regardless of what kind of cell it is, whether muscle cell or brain cell.
If the DNA in all the chromosomes in a single cell were stretched out and laid end- to-end it would reach 2 metres in length. The total length of all the chromosomes in your body is therefore 2 metres x 100 thousand billion cells = 200 thousand billion kilometres or the distance of about 700 journeys to the sun and back !
Amazingly, every cell in your body contains an identical set of these 46 chromosomes. In other words, every cell contains a complete copy of your genetic code - regardless of what kind of cell it is, whether muscle cell or brain cell.
If the DNA in all the chromosomes in a single cell were stretched out and laid end- to-end it would reach 2 metres in length. The total length of all the chromosomes in your body is therefore 2 metres x 100 thousand billion cells = 200 thousand billion kilometres or the distance of about 700 journeys to the sun and back !
And that is just in you! Imagine how far into space the DNA in all
human beings on earth would stretch – all 6.7 billion of us!
However, that’s enough of this mind blowing stuff for the moment.
Let’s get down to earth again and ask where did these chromosomes,
your genetic code, come from?
Well, it’s all down to sex, as ever. You inherited 23 of these chromosomes from your father’s sperm at the moment of conception. The other 23 chromosomes came from your mother’s egg. Note that the sperm and egg cells contain only 23 chromosomes each – the only cells in your body to contain this number of chromosomes. The 46 chromosomes contain all the instructions needed to make you who and what you are.
Well, it’s all down to sex, as ever. You inherited 23 of these chromosomes from your father’s sperm at the moment of conception. The other 23 chromosomes came from your mother’s egg. Note that the sperm and egg cells contain only 23 chromosomes each – the only cells in your body to contain this number of chromosomes. The 46 chromosomes contain all the instructions needed to make you who and what you are.
|
Together, the sperm and the egg produce a single fertilised cell
that then divides in the womb and makes 2 copies. Each of these then divides
and make 4 copies and they in turn make 8 copies and so on until eventually
there is a baby ready to be born – made up of about 430 billion cells.
|
We continue to grow throughout childhood making more copies of our
cells until we reach that staggering total of about 100 thousand billion cells
in the adult human body.
Amazingly every time a cell divides, perfect copies are also made of those 46 chromosomes to give to the new cells. So,every cell in your body contains a copy of that blue print that was first given, in my case 62 years ago when I was conceived!
Amazingly every time a cell divides, perfect copies are also made of those 46 chromosomes to give to the new cells. So,every cell in your body contains a copy of that blue print that was first given, in my case 62 years ago when I was conceived!
So how does
this DNA in the chromosomes work?
In fact, DNA is a just a string of only four simple molecules called bases. They are called adenine, tyrosine, guanine and cytosine, but from now on we will refer to them only by the initial letters in their names: A, T, G and C. They are strung out, apparently at random, like the strand of a necklace made up of four different gemstones, like this :
In fact, DNA is a just a string of only four simple molecules called bases. They are called adenine, tyrosine, guanine and cytosine, but from now on we will refer to them only by the initial letters in their names: A, T, G and C. They are strung out, apparently at random, like the strand of a necklace made up of four different gemstones, like this :
The string from which the bases are strung is
made up of sugar and phosphate molecules. The sugar is called deoxyribose from
which the letters DNA (Deoxyribo Nucleic Acid) derive.
In fact there are two strands of DNA. These are linked together at the bases and are coiled around each other in a long spiral (called a helix). Even the links between the strands are simple: C only links with T and G only with C. These are called base pairs.
In fact there are two strands of DNA. These are linked together at the bases and are coiled around each other in a long spiral (called a helix). Even the links between the strands are simple: C only links with T and G only with C. These are called base pairs.
If the DNA in a chromosome is uncoiled and laid flat, the order of
the bases can be read:
So what does this sequence of bases
do?
The bases are read in order, as a series of three letter ‘words’ called codons. Each codon is a key for a molecule of amino acid. We obtain these amino acids from the food we eat. They are transported in the blood stream to the cells. We need 22 different amino acids in our diet. Here are just six of these amino acids and the codons which are their keys.
The bases are read in order, as a series of three letter ‘words’ called codons. Each codon is a key for a molecule of amino acid. We obtain these amino acids from the food we eat. They are transported in the blood stream to the cells. We need 22 different amino acids in our diet. Here are just six of these amino acids and the codons which are their keys.
Amino acids are joined together in the cell to make proteins. Proteins
are what tissues in the body are made from and also complex molecules like enzymes,
hormones and antibodies.
The cell needs to know which amino acids to choose and the order
in which they are to be brought, in order to make a molecule of a particular protein.
The cell also needs to know when to
start assembling the amino
acids into a protein and when to stop, so there are START and STOP
codons
too.
|
Here is an example.
Hair is made from a protein called Keratin. Keratin is made by the cells in a hair follicle (there are about a million such cells at the root of every hair). |
|
Keratin is made from 552 amino acids. They are chosen and assembled in the right order in the follicle cell to make keratin. This is done by a sequence of 1656 bases (= 3x552 codons = 552 amino acids) on a chromosome which is called the gene for keratin.
Here are the first few codons from that gene:
Here are the first few codons from that gene:
Bases:
ATGTCTACCAAAACCACCATC ........ then 1644 more bases until ..... TGA
Divide the bases off into threes to give the codons :
ATG TCT ACC AAA ACC ACC ATC ...... TGA
Amino acids :
START --- ser ---thr---lys--- thr---thr---ile--- ...... STOP
ATGTCTACCAAAACCACCATC ........ then 1644 more bases until ..... TGA
Divide the bases off into threes to give the codons :
ATG TCT ACC AAA ACC ACC ATC ...... TGA
Amino acids :
START --- ser ---thr---lys--- thr---thr---ile--- ...... STOP
The cell keeps adding more amino acids in the correct order
until it comes to the STOP codon, at which point the molecule
keratin is complete. The molecule goes on to join millions of other keratin
molecules made by the other follicle cells that together form a human hair.
In this way your cells keep manufacturing the proteins that your body needs for growth, repair and to keep it functioning. It also explains why you need to have your hair cut regularly (those of you that have any hair!).
In this way your cells keep manufacturing the proteins that your body needs for growth, repair and to keep it functioning. It also explains why you need to have your hair cut regularly (those of you that have any hair!).
Altogether, we have about 3 billion base pairs in our chromosomes and about 20,000 genes – as befits an organism as complex as a human being. However the number of base pairs is no clue to the complexity of an organism. There is an amoeba that possesses 670 billion base pairs in its chromosomes !
Furthermore, our genes are not special to us either. We share about
98% of our genes with chimpanzees, about 85% of our genes with a harvest mouse,
60% with a fruit fly and even 50% with the banana it flies around!
DNA is truly amazing stuff but the story is complex.
If you need some help, please email me.
Ron East
DNA is truly amazing stuff but the story is complex.
If you need some help, please email me.
Ron East
GLOSSARY
Base : one of the four molecules A, T, G or C that make up our genetic code
base pair : G paired with C or A paired with T
gene : a sequence of amino acids that assemble to make a protein
codon : a sequence of three bases that identify a particular amino acid
amino acid : a molecule obtained by digesting foods, particularly meat, eggs, pulses etc
nucleus : the central part of a cell that contains chromosomes
chromosomes : coiled, very long molecules made from DNA
DNA : deoxyribonucleic acid
Protein : a molecule made by joining amino acids together
Billion : is one thousand million or 1000 000 000 or 109
Base : one of the four molecules A, T, G or C that make up our genetic code
base pair : G paired with C or A paired with T
gene : a sequence of amino acids that assemble to make a protein
codon : a sequence of three bases that identify a particular amino acid
amino acid : a molecule obtained by digesting foods, particularly meat, eggs, pulses etc
nucleus : the central part of a cell that contains chromosomes
chromosomes : coiled, very long molecules made from DNA
DNA : deoxyribonucleic acid
Protein : a molecule made by joining amino acids together
Billion : is one thousand million or 1000 000 000 or 109
Royalty Free Music
from Themusicase.com
from Themusicase.com